
Problem 2 (40 Marks)
The PCR primer shown in Figure 1 was designed to anneal to the 3’ end of the target
sequence shown in Figure 2 as part of an experiment designed to amplify a gene
fragment containing 2341 base pairs (only the last 60 nucleotides of the 3’ to 5’
strand in that 2341 base pair fragment are shown).
Figure 1: Primer sequence
5’-GGGGGGTCT-3’
Figure 2: Template sequence
2341 2331 2321 2311 2301 2291 2281
| | | | | | |
3’CCCCCCAGAAATTTACCTAAGCGGGCACAATGAGTTATTTCAGCCCTTATCAGCTCACTG
1.1 State two reasons for why the PCR reaction is likely to fail, one based on the
primer and its likely effects along with one based on the nucleotide sequence of
the template. Your answer should include what measures (if any) can be taken to
eliminate the potential template problem and calculation of the melting
temperature associated with the primer.
[15 Marks]
1.2 Design a more optimal primer stating its sequence and two ways in which it has
been improved.
[13 Marks]
1.3 Assuming that an optimal primer has been successfully constructed for the
complementary template strand (not shown) that has a melting temperature of
62 degrees, design an appropriate PCR program for amplifying the gene fragment
based on that shown in the week 13 “PCR amplification of DNA” slides. You can
also assume that the polymerase to be used has an extension rate of 1.5 minutes
per kilobase and optimal activity at 69 degrees.
[12 Marks]