
BIOL_A108 Module 2 Bioinformatics Exercise: Sequence Alignment LAB
25 pts. Individual, due week 8 W/Th. in lab. You can collaborate with your group.
Name: Section/TA:
1. (25pts.) Sequence search by alignment (BLAST). You designed primers targeting a human mitochondrial gene (COX1) and you run PCR on ancient DNA found in a paleolithic cave in France. You see a 700bp amplicon on gel electrophoresis. This is the Sanger DNA sequence of your 700bp PCR amplicon:
>MY_CAVE_DNA_SEQUENCE_700bp
ATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACATTGGAACACTATACCTACTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCTCTAAGCCTCCTTATTCGAGCCGAACTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACATCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGGGGCTTTGGCAACTGACTAGTTCCCTTAATAATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAATATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCTGCTCGCATCTGCTATAGTGGAAGCCGGCGCAGGAACAGGTTGAACAGTCTACCCTCCCTTAGCAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAGCAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATTAATATAAAACCCCCTGCCATAACCCAATACCAAACGCCCCTTTTCGTCTGATCCGTCCTAATCACAGCAGTCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTACTAACAGACCGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCAGTACCTATT
(a) What organism do you expect your sequence to be from? Why? Why might it actually be the DNA of another organism?
(b) BLAST your sequence at NCBI BLAST to search against all possible DNA sequences reported. Input your sequence (query) with Parameters: Database standard (nr/nt) – to try all sequences as subjects (unbiased), and Optimize for: Somewhat similar sequences (blastn) – to allow for mismatches. BLAST is at the link: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome
• The BLAST results page has a “RID” link (upper left). Copy RID link paste here (or put RID number):
• Look at “Descriptions” tab. What is the closest DNA match to your 700bp amplicon?
• What organism did your DNA likely come from (top hit)? What other H. sapiens subspecies are also a very close match (listed)?
• Click on the link showing the top BLAST hit (top of match list). What is the Sequence_ID:
Species:
What is the identity (nt/nt, %):
(c) You collect a second sample from the cave, and you repeat the DNA purification, PCR, gel electrophoresis and DNA sequencing. Your “band” on the gel was a bit weak (faint), and you had to run the PCR another time with a lower annealing temperature to get enough amplicon to sequence.
>MY_SECOND_CAVE_DNA_SEQUENCE_700bp
ATGTTCATAAATCGGTGATTATTCTCTACGAACCATAAAGACATTGGCACTCTTTACCTTCTATTCGGTGCATGAGCCGGAATAGTGGGTACTGCCCTCAGCCTTTTAATTCGTGCCGAGCTGGGTCAGCCTGGGGCCCTGTTGGGGGATGATCAGATCTACAATGTAGTCGTAACTGCCCATGCGTTCGTGATAATCTTCCTCATAGTCATACCTATTATAATTGGGGGGTTCGGGAACTGATTAGTGCCCTTAATGATCGGTGCCCCCGACATAGCGTTTCCTCGAATGAATAACATAAGCTTCTGGTTACTGCCACCATCCTTCTTATTGCTTCTGGCCTCTTCTATGGTAGAAGCAGGTGCAGGAACTGGATGAACTGTCTACCCCCCTCTAGCGGGTAATCTGGCCCATGCAGGAGCATCAGTAGACCTAACAATCTTTTCTCTGCACCTAGCAGGTATCTCTTCTATTCTGGGAGCTATTAATTTCATCACTACTATTATTAACATGAAGCCCCCTGCAATATCTCAATATCAAACACCTCTATTTGTATGATCAGTCCTAATCACAGCCGTACTTCTTCTTTTATCTTTACCAGTCTTAGCAGCTGGGATTACTATACTACTTACAGAT
• BLAST the sequence.
• RID:
• What organism have you identified in the cave now?
• If you had been there visiting friends in the cave, to see their new red ochre paintings, when this organism came prowling, what would you have done?
(d) What do you think about paleolithic cave painting as an art form?